- Journal List
- Int J Exp Pathol
- v.99(1); 2018 Feb
- PMC5917390
As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsem*nt of, or agreement with, the contents by NLM or the National Institutes of Health.
Learn more: PMC Disclaimer | PMC Copyright Notice
Int J Exp Pathol. 2018 Feb; 99(1): 46–53.
Published online 2018 Apr 15. doi:10.1111/iep.12264
PMCID: PMC5917390
PMID: 29656466
Alaknanda Mishra,1 Shailendra Arindkar,1 Preeti Sahay,1 Jerald Mahesh Kumar,2 Pramod K. Upadhyay,1 Subeer S. Majumdar,1,3 and Perumal Nagarajan
1
Author information Article notes Copyright and License information PMC Disclaimer
Summary
Non‐alcoholic fatty liver disease (NAFLD)‐like conditions enhance the production and action of clotting factors in humans. However, studies examining the effect of NAFLD due to high‐fat high‐fructose (HFHF) diet in factor VIII‐deficient (haemophilia A) animals or patients have not been reported previously. In this study, we investigated the individual role of factor VIII in the progression of diet‐induced NAFLD in the factor 8−/− (F8−/−) mouse model system and its consequences on the haemophilic status of the mice. The F8−/− mice were fed with HFHF diet for 14weeks. Physiological, biochemical, haematological, molecular, pathological, and immune histochemical analyses were performed to evaluate the effect of this diet. The F8−/− mice developed hepatic steatosis after 14 weeks HFHF diet and displayed lower energy metabolism, higher myeloid cell infiltration in the liver, decreased platelet count, upregulated de novo fatty acid synthesis, lipid accumulation, and collagen deposition. This study helps to understand the role of factor VIII in NAFLD pathogenesis and to analyse the severity and consequences of steatosis in haemophilic patients as compared to normal population. This study suggests that haemophilic animals (F8−/− mice) are highly prone to hepatic steatosis and thrombocytopenia.
Keywords: factor 8−/−, haemophilia A, high‐fat high‐fructose, metabolism, non‐alcoholic fatty liver disease
Liver diseases, either acute or chronic, are consistently related to coagulation disorders for a variety of reasons including the distorted production of clotting and inhibitory factors, platelet defects, hyperfibrinolysis, and increased intravascular coagulation (Amitrano etal. 2002). It has been recently reported that coagulation factors VIII, IX, and XI show a significant elevation in obese subjects and in a population suffering from metabolic syndromes (Kotronen etal. 2011). Tripodi etal. (2014) reported that a procoagulant imbalance occurs while steatosis progresses towards metabolic cirrhosis. Nevertheless, the role of factor VIII in the pathogenesis and progression of high‐fat high‐fructose (HFHF) diet‐induced non‐alcoholic fatty liver disease (NAFLD) has not been studied in haemophilic patients. Also, the effect of HFHF diet in patients on their haemophilic condition remains elusive.
In a recent study, it was suggested that the overweight and obese haemophilic children showed a severe disease profile and a persistently high alanine aminotransferase (ALT) value was observed in these patients some of which had clear signs of NAFLD (Revel‐Vilk etal. 2011). In yet another report, Majumdar etal. (2010) concluded that there was a very high prevalence of obesity in the Mississippi haemophilic population. Recent studies also showed that von Willebrand factor (VWF) plasma concentration is strongly elevated in mice deficient in factor VIII and shows signs of hepatic inflammation, as indicated by increased tumour necrosis factor alpha (TNF‐α), CD45, and TLR4 transcripts, and by elevated macrophage counts in the liver (Kiouptsi etal. 2017). Hence, we hypothesized that HFHF diet affects the liver of mice deficient in factor VIII more profoundly and causes NAFLD which consequently worsens the haemophilic condition. As liver sinusoidal endothelial cells (LSECs) play a major role in the biosynthesis of factor VIII (Fahs etal. 2014) and also damaged LSECs lead to consequent activation and recruitment of Kupffer cells and myeloid cells like neutrophils and dentritic cells (DCs) (Eckert etal. 2015), we wanted to check whether LSECs undergo HFHF diet‐induced damage in F8−/− animals which may cause NAFLD and also further compromise the haemophilic condition.
Therefore, in our present study, we have evaluated and characterized the severity of hepatic steatosis caused due to HFHF diet and studied its effect on haemophilia A disorder in the F8−/−mice.
Methods
Ethical approval statement
All experimental animal care and handling were performed in accordance with the guidelines of CPCSEA (Committee for the Purpose of Control and Supervision of Experiments on Animals). The animal experimental protocol was approved by the Institutional Animal Ethics Committee National Institute of Immunology (IAEC No 418/16).
Animals
Six‐week‐old factor 8−/− male mice (F8 knockout mice Jackson B6; 129S‐F8tm1Kaz/J) (Jackson Laboratories, Bar Harbor, ME, USA) were used in this study. All animals were housed in an individual caging system with proper access to water and feed adlibitum. The mice were divided into two batches, that is control (n=7) and treated (n=7). The diet of control mice included 4.5% fat and 22% crude protein supplemented diet (total energy 3802kcal/kg), while the treated group was supplemented with a diet containing 30% fat and 18% crude protein supplemented dietalong with an additional 50% (w/w fructose) (HiMedia, Mumbai, India). This special diet is denoted as HFHF diet, which has a total energy content of 5202kcal/kg.
Biochemical analysis
The animals were monitored for weight gain after every 2weeks, and the liver weight was measured at the end of diet treatment. Blood was collected at the end of the study by cardiac puncture under anaesthesia (80 and 10mg/kg body weight of ketamine hydrochloride and xylazine respectively) for various experiment mentioned below. Serum biochemistry was performed using in‐house serum auto‐analyzer Screen Master 3000, Tulip, Alto Santa Cruz, India, and haematology analysis was carried out using automated vet haematology counter (Melet Schloesing Laboratories, Guwahati, India) according to manufacturer's instruction. Total liver triglyceride (TG) was extracted as described earlier by Folch etal. (1957) followed by quantification of Coral GPO‐PAP kit (CORAL Clinical systems, Goa, India) using manufacturers’ instructions.
Histological analysis
Haematoxylin–eosin (H&E), picro‐sirius, and Oil red O (ORO) staining were performed for liver tissue sections. The severity of liver degeneration was scored according to the semi‐quantitative scoring system as proposed by NASH Clinical Research Network. Collagen content was quantified in picro‐sirius‐stained images using image J software (National Institute of Health, MD, USA). Further hydroxyproline content of the liver tissue was estimated as described earlier (Reddy & Enwemeka 1996). Representative photomicrographs were captured at 40× magnification.
Immunodetection of LSECs and myeloid cells in the liver
Immunostaining for CD31 (liver sinusoidal endothelial marker), CD14 (macrophage marker), CD11c (dendritic cell marker), and Ly6G/C (neutrophil marker) was performed according to standard protocols. Briefly, the liver tissue sections were deparaffinized and antigen retrieval was performed using citrate buffer at 95°C. The sections were stained with primary antibodies (CD31, CD14, CD11c, and Ly6G/C) at 1:200 dilution (all from e‐biosciences, San Diego, CA, USA) followed by secondary antibody treatment with anti‐mouse Alexa Fluor 488 (Molecular Probes, Eugene, OR, USA). Nuclei were stained with propidium iodide (PI), and images were acquired in LSM Zeiss (Carl Zeiss, Jena GmBH, Germany) confocal microscope at 63×.
Quantitative PCR analysis
RNA was isolated using Trizol reagent (MRC Inc, Cincinnati, OH, USA), and cDNA was prepared according to manufacturer's instruction (Bio‐Rad, Hercules, CA, USA). Quantitative real‐time PCR was performed with SYBR green master mix (Thermo Fisher Scientific, Waltham, MA, USA) on the Master cycler RealPlex4 platform (Eppendorf, Germany). The primer pairs and PCR conditions used are listed in Tables1 and 2. 18S rRNA was used to normalize the expression of genes, and their relative expression was calculated against respective controls using the ΔΔCt method.
Table 1
List of primers used for comparison of gene expression profile related to energy metabolism, fatty acid synthesis, inflammation, and insulin resistance between F8−/− control and high‐fat high‐fructose‐treated groups
| Genes | Forward primer | Reverse primer |
|---|---|---|
| PGC‐1β | GCCCGGTACAGTGAGTGTTC | CTGGGCCGTTTAGTCTTCCT |
| ChREBP | GATGGTGCGAACAGCTCTTCT | CTGGGCTGTGTCATGGTGAA |
| SREBP1c | GATGTGCGAACTGGACACAG | CATAGGGGGCGTCAAACAG |
| FAS | ATCCTGGAACGAGAACACGATCT | AGAGACGTGTCACTCCTGGACTT |
| SCD1 | TGGGTTGGCTGCTTGTG | GCGTGGGCAGGATGAAG |
| PPARα | CGGGAAAGACCAGCAACAAC | TGGCAGCAGTGGAAGAATCG |
| IRS1 | CTCTACACCCGAGACGAACAC | TGGGCCTTTGCCCGATTATG |
| IRS2 | GGAGAACCCAGACCCTAAGCTACT | GATGCCTTTGAGGCCTTCAC |
| PEPCK | CAGGATCGAAAGCAAGACAGT | AAGTCCTCTTCCGACATCCAG |
| G6Pase | GAAAAAGCCAACGTATGGATTCC | CAGCAAGGTAGATCCGGGA |
| TNFα | AAGCCTGTAGCCCACGTCGTA | GGCACCACTAGTTGGTTGTCTTTG |
| IL‐6 | ATGGATGCTACCAAACTGGAT | TGAAGGACTCTGGCTTTGTCT |
| PPAR γ | ATGCCAAAAATATCCCTGGTTTC | GGAGGCCAGCATGGTGTAGA |
| CPT‐1 | ACCACTGGCCGAATGTCAAG | AGCGCGTAGCGCATGGTCAT |
| ACC | ATATGTTCGAAGAGCTTATATCGCCTAT | TGGGCAGCATGAACTGAAATT |
| CRP | TACTCTGGTGCCTTCTGAT | GGAAGTATCTGACTCCTTGG |
| IFN‐γ | GGCCATCAGCAACAACATAAGCGT | TGGGTTGTTGACCTCAAACTTGGC |
| MCP‐1 | GGAAAAATGGATCCACACCTTGC | TCTCTTCCTCCACCACCATGCAG |
| 18S rRNA | GTAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
Open in a separate window
CRP‐C reactive protein; ChREBP, carbohydrate‐responsive element binding protein; FAS, fatty acid synthase; G6Pase, glucose 6‐phosphatase; IL‐6, interleukin 6; IRSI, insulin receptor substrate 1; IRS2, insulin receptor substrate 2 alpha; PGC1a, peroxisome proliferative activated receptor gamma coactivator 1; PRARa, peroxisome proliferator‐activated receptor alpha; rRNA, ribosomal ribonucleic acid; PEPCK, phosphoenolpyruvate carboxykinase 1; SREBP1c, sterol regulatory element binding proteins; SCD1, stearoyl‐CoA desaturase‐1; TNFα, tumour necrosis factor alpha.
Table 2
RT‐PCR conditions
| Step | Temperature | Time |
|---|---|---|
| Initial denaturation | 95°C | 7 min |
| Denaturation | 95°C | 15 s |
| Annealing and extension | 60°C | 1 min |
| Final extension | 60°C | 5 min |
Open in a separate window
Statistical analysis
The results are presented as the mean±standard deviation (SD). Statistical significance of differences between two or many groups for a singular parameter has been determined by one‐way analysis of variance (anova) or unpaired t‐test, and multiparametric analysis was performed by two‐way anova using Bonferroni post hoc tests (graph pad prism software, Version 5.04, (La Jolla, CA, USA)). The value of P<0.05 (95% CI) has been considered significant.
Results
High‐fat high‐fructose‐treated factor VIII‐deficient mice show increased weight, reduced platelet count, and liver triglyceride accumulation
Factor 8−/− mice fed with HFHF diet had an increase in body and liver weight as compared to their control group (Figure1a,b). The mean serum ALT was increased slightly, while cholesterol (CHO) and TG levels were significantly higher in the HFHF‐treated group as compared to control group (Figure1c–e) resembling signature features of NAFLD. The platelet count was highly reduced in HFHF‐treated group (Figure1f) and also exhibited a higher WBC count (Table3) as compared to control group. There was also a reduction in haematocrit and haemoglobin levels of the HFHF‐fed mice (Table3). The liver TG content was significantly higher in HFHF‐treated group suggesting steatotic changes (Figure1g).
Figure 1
(a) The graphical representation of body weight gain over time (0–14weeks) and (b) liver weight changes at the end of 14weeks in F8−/− control and treated groups. A significant weight gain was observed in high‐fat high‐fructose (HFHF)‐treated F8−/− mice (P<0.0001 at 14weeks). Liver weight also increased in the treated F8−/− group (P<0.05). (c) alanine aminotransferase (ALT) levels were increased in the HFHF‐fed F8−/− mice and other biochemical parameters like (d) cholesterol (P<0.0001). (e) Triglyceride (TG) (P<0.0001) were significantly elevated. (f) The HFHF‐treated F8−/− mice also exhibited thrombocytopenia (reduced platelet count; P<0.01) and (g) higher accumulation of liver TG content. Each parameter was analysed between the two groups using unpaired t‐test (n=7). P<0.05=*, P<0.01=**, P<0.001=***, P<0.0001=****. [Colour figure can be viewed at http://wileyonlinelibrary.com]
Table 3
Comparison of haematology parameters between control and high‐fat high‐fructose‐treated F8−/− mice (N=7)
| Parameters | Factor 8−/− mice control | Factor 8−/− mice HFFD treated |
|---|---|---|
| WBC (103/μl) | 6.15±2.01 | 7.42±0.55 |
| RBC (106/μl) | 10.375±0.93 | 8.932±0.42 |
| HCt (%) | 54.975±5.03 | 48.6±2.83 |
| MCV (fl) | 55.3±3.05 | 54.46±0.94 |
| Hb (g/dl) | 18.525±2.32 | 15.78±0.99 |
| Platelets (m/mm3) | 519.25±46.89 | 335.6±63.08 |
| MPV (fl) | 6.5±0.54 | 6.52±0.40 |
| PCt (%) | 0.335±0.03 | 0.218±0.048 |
| PDW | 8.725±0.91 | 8.24±0.65 |
| MCH (pg) | 17.775±0.80 | 17.6±0.45 |
| MCHC (g/dl) | 32.2±1.01 | 32.4±0.71 |
| RDW | 13.825±4.03 | 11.512±0.55 |
Open in a separate window
Fl, femtoliters; dl, deciliters; %, percentage; pg, picograms; g/dl, gram per decilitre; m/mm3, million per millimetre3; μl, microlitres.
High‐fat high‐fructose‐fed factor VIII‐deficient mice developed fatty liver changes, lipid accumulation, and collagen deposition
The H and E staining confirmed the presence of microvesicular and macrovesicular fatty changes in the parenchyma of the liver in HFHF‐treated factor 8−/− mice. The lobular changes and ballooning of the liver were scored for both the groups by NAFLD activity score (NAS), and the scores for treated group were between 2 and 4, while the control group had a score below 1 (Figure2a,d). Approximately 2% Picro‐sirius red staining was obtained for collagen in HFHF diet fed factor 8−/− mice as against 0.5% in control groups (Figure2b,e) suggesting collagen deposition in the liver. We could also find a significant accumulation of lipid droplets in the treated group, while levels of hydroxyproline were also minutely increased (Figure2c,f).
Figure 2
(a) Representative images showing H and E staining (b) Picro‐sirius red staining and (c) Oil red O (ORO) staining in liver sections of control and high‐fat high‐fructose (HFHF)‐treated F8−/−mice. The H and E analysis revealed the presence of microvescicles and macrovescicles in the liver parenchyma of the treated group. Oil red O staining indicated the presence of large oil globules (stained in red) present in treated groups as against their respective control groups. (d) The NAFLD activity score (NAS) score of control F8−/− mice was <1, while HFHF‐treated mice exhibited a score between 2 and 4 (P<0.001). (e) Picro‐sirius red staining demonstrated collagen deposition and suggested an increase from 0.5% in control F8−/− mice to around 2% in the treated F8−/− mice (P<0.0001). (f) Hydroxyproline levels showed no significant change suggesting the absence of fibrosis. The data were analysed using unpaired t‐test for each parameter (n=4). P<0.05 = *, P<0.01 = **, P<0.001 = ***, P<0.0001 = ****. [Colour figure can be viewed at http://wileyonlinelibrary.com]
The HFHF‐treated F8−/− mice have damaged LSECs and upregulated myeloid cell infiltration in liver
Liver sinusoidal endothelial cells stained with CD31 in the liver were scattered and in both control and treated group; however, the cells developed a thickened basem*nt membrane and the level of CD31 staining further reduced in HFHF‐treated F8−/− mice owing to the effect of developing NAFLD on LSECs viability and phenotype (Figure3a). We found an increased infiltration of myeloid lineage cells like macrophages (CD14+), dendritic cells (CD11c+), and neutrophils (Ly6G/C+) in HFHF‐treated F8−/− mice as compared to control group (Figure3b–d) which signifies that alterations in phenotype of LSECs owing to F8 gene mutation could have led to recruitment of antigen presenting cells in HFHF treated factor VIII‐deficient animals causing NAFLD‐like condition.
Figure 3
(a) Representative confocal images (630×) of 5‐μ liver sections immunostained with CD31 or PECAM‐1 [liver sinusoidal endothelial cells (LSEC) marker], (b) CD14 (Kupffer cell or macrophage marker), (c) CD11c (dendritic cell marker), and (d) Ly6G/C (neutrophil marker) all counterstained with anti‐mouse Alexa Fluor 488 (Molecular Probes, Eugene, OR, USA) secondary antibody. CD31‐positive cells in control F8−/− mice and treated F8−/− mice were scanty which further showed damaged phenotype with the sporadic arrangement and thickened basem*nt membrane in high‐fat high‐fructose (HFHF)‐treated F8−/− animals. We also observed an increase in the expression of CD14, CD11c, and Ly6G/C in treated F8−/− mice as compared to its control group indicating myeloid cell infiltration in treated liver. [Colour figure can be viewed at http://wileyonlinelibrary.com]
The HFHF‐treated F8−/− mice show upregulated fatty acid synthesis and inflammation
The expression pattern of several genes functional during the progression of NAFLD was evaluated in HFHF‐treated F8−/− mice as compared to control group. There was significant upregulation of de novo fatty acid synthesis genes except SCD‐1 that was downregulated in the treated group as against control (Figure4a). The energy metabolism genes in treated F8−/−mice did not show any significant change. Genes like PGC‐1b, ACC, and PPAR‐a showed a slight increase in expression, while PPAR‐g and CPT‐1a were downregulated (Figure4b). The inflammatory markers displayed unanimous elevated expression in the treated group, and the level of TNF‐α was significantly upregulated (Figure4c). Furthermore, the insulin resistance gene G6Pase had significantly increased expression, while IRS‐1 also exhibited upregulation in the treated group indicating HFHF diet‐induced hyperglycaemic conditions but undisrupted insulin signalling and tolerance (Figure4d).
Figure 4
(a) De novo fatty acid synthesis genes like ChREBP and FAS showed significant upregulation (P<0.01 and 0.05 respectively) in treated F8−/− mice, while SREBP‐1c was only slightly elevated. However, SCD‐1 showed significant downregulation in the treated group as compared to control. (b) Energy metabolism genes exhibited only slight upregulation of PGC 1b, ACC, and PPAR‐a in treated F8−/− mice. PPAR‐γ and CPT‐1, whose downregulation marks aggravated obesity and steatosis, exhibited alleviated levels in treated F8−/− mice. (c) Inflammatory genes in the liver like tumour necrosis factor alpha (TNF‐α) was significantly upregulated in high‐fat high‐fructose (HFHF)‐treated F8−/− mice (P<0.05). IL‐6, CRP, IFN‐g, and MCP‐1 genes also showed slightly increased expression in treated F8−/− mice. (d) IRS‐1, IRS‐2 exhibited elevated expression in treated group against control F8−/− mice, while G6Pase (P<0.01) was significantly upregulated indicating hepatic hyperglycaemic condition but the absence of insulin resistance. PEPCK, however, showed downregulation in treated F8−/− mice as against the control F8−/− mice. Both the groups were analysed using unpaired t‐tests for significance (n=6). P<0.05 = *, P<0.01 = **, P<0.001 = ***, P<0.0001 = ****.
Discussion
The present study evaluated the effect of HFHF diet on F8−/− mice to understand their tendency towards an obesity phenotype and their exaggerated chances of developing NAFLD.
As LSECs and myeloid cells like Kupffer cells in liver are considered as the central source of factor VIII production (Follenzi etal. 2012; Everett etal. 2014) which are also involved in fatty liver and NAFLD (Miyao etal. 2015), we hypothesized that factor VIII deficiency might be correlated with exacerbation of NAFLD after a HFHF diet intake. It has also been reported earlier that at least 34.5% of haemophilic patients older than 20years in the United States are overweight and 23.5% are obese. Moreover, at least 16.4% of haemophilic children are overweight as against 13.7% of the general population (Wong etal. 2011). It has also been observed that overweight children suffer from nore severe haemophilic manifestations and a persistently high ALT value signifying the onset of NAFLD (Revel‐Vilk etal. 2011).
In agreement with these reports, we found that the HFHF‐fed F8−/− animals gained significant body weight and liver weight, which can be a result of hepatic inflammation and lipid deposition as suggested by increased mRNA transcript levels of genes involved in inflammation and de novo fatty acid deposition. We also found an increase in serum levels of ALT in treated F8−/− mice, which was probably associated with the cellular immune response in the liver induced with myeloid cell (macrophages, dendritic cells, and neutrophils) infiltration during HFHF diet treatment. The level of CHO, serum TG, and total liver TG content also increased in treated F8−/− mice as reported earlier (Kawano & Cohen 2013). This corresponds to the hypercholesterolemia and hypertriglyceridaemia which developed during NAFLD (Enjoji etal. 2012). An interesting observation was the reduced platelet count in HFHF‐treated F8−/−mice. The decrease in the platelet during HFHF diet has a detrimental effect on the health of patients as platelets play a major role in the formation of the platelet plug during clot formation (Riedla etal. 2017). Therefore, the decreased level of platelets and the increase in WBC count in HFHF diet fed F8−/− mice is probably related to the detrimental effect of NAFLD on clotting efficiency of these animals. Histopathological changes include microvesicles and macrovesicles formation in F8−/− HFHF‐treated group as compared to control group. Heavy collagen deposition and significant lipid accumulation in liver sections were also observed in the treated groups, suggesting it suffers from NAFLD symptoms. Hydroxyproline quantification revealed only a slight increase in the treated group, suggesting that there was lack of fibrosis (Verma etal. 2013). Immunodetection and analysis of LSECs (CD31+) in liver suggested visible but scattered CD31 staining in F8−/−control group which was further reduced in HFHF‐treated group. The fewer CD31+ cells present in the treated group exhibit damaged phenotype with thickened basem*nt membrane and sporadic presence, which is a signature of capillarization during liver diseases as reported earlier (Xu etal. 2003). The damaged LSECs are capable of recruiting immune cells into the liver causing hepatic inflammation and steatosis (Miyao etal. 2015). Besides, the fatty acid synthesis genes and inflammatory genes also exhibited significant upregulation, while energy metabolism genes had no significant change.
To conclude, the mice deficient in factor VIII are highly prone to an obesity phenotype upon intake of high‐calorie diet and are more prone towards developing exaggerated NAFLD. This gain in weight and progression towards fatty liver may possibly worsen their clotting abnormality by prolonging the clotting time. Therefore, it can also alter the expected outcome of replacement therapies where factor VIII and its recombinant forms are injected in patients based on their metabolism, weight, factor deficiency, severity, and bleeding circ*mstance as reported by Henrard etal. (2013). If this is not monitored and taken into account then replacement therapy may not be completely effective as a remedy for the underlying disease condition. Also, the outcome of cell‐based therapies where LSECs or unfractionated hepatocytes are transplanted (Kumaran etal. 2005; Fomin etal. 2014) can become unpredictable in such patients who exhibit NAFLD‐like condition due to various peripheral blood and liver immunological changes that occur. Although a definite study on human haemophilia A patients will provide a better insight, however, based on our study in F8−/− mice, it is recommended that patients suffering from haemophilia A must avoid high fat and fructose diet which can lead to aggravated weight gain and hepatic steatosis.
Declaration
All authors declare that there is no competing interest or conflict of interest.
Acknowledgements
The authors wish to thank the Director, National Institute of Immunology for providing kind support with the funds originated from the Department of Biotechnology, India. The authors also wish to thank Mr. Subash Dogra for technical help in this study. We also thank Dr. S Gopalan Sampath Kumar for critical reading of the manuscript.
References
- Amitrano L., Guardascione M.A., Brancaccio V. & Balzano A. (2002) Coagulation disorders in liver disease. Semin. Liver Dis.22, 83–96. [PubMed] [Google Scholar]
- Eckert C., Klein N., Kornek M. & Lukacs‐Kornek V. (2015) The complex myeloid network of the liver with diverse functional capacity at steady state and in inflammation. Front. Immunol.6, 179. [PMC free article] [PubMed] [Google Scholar]
- Enjoji M., Yasutake K., Kohjima M., Nakamuta M. (2012) Nutrition and nonalcoholic fatty liver disease: the significance of cholesterol. Int. J. Hepatol.2012, 925807. [PMC free article] [PubMed] [Google Scholar]
- Everett L.A., Cleuren A.C., Khoriaty R.N. & Ginsburg D. (2014) Murine coagulation factor VIII is synthesized in endothelial cells. Blood123, 3697–3705. [PMC free article] [PubMed] [Google Scholar]
- Fahs S.A., Hille M.T., Shi Q.etal (2014) A conditional knockout mouse model reveals endothelial cells as the principal and possibly exclusive source of plasma factor VIII. Blood123, 3706–3713. [PMC free article] [PubMed] [Google Scholar]
- Folch J., Lees M. & Sloane‐Stanley G.H. (1957) A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem.226, 497. [PubMed] [Google Scholar]
- Follenzi A., Raut S., Merlin S.etal (2012) Role of bone marrow transplantation for correcting hemophilia A in mice. Blood119, 5532–5542. [PMC free article] [PubMed] [Google Scholar]
- Fomin M.E., Togarrati P.P. & Muench M.O. (2014) Progress and challenges in the development of a cell‐based therapy for hemophilia A. J. Thromb. Haemost.12, 1954–1965. [PMC free article] [PubMed] [Google Scholar]
- Henrard S., Speybroeck N. & Hermans C. (2013) Impact of being underweight or overweight on factor VIII dosing in hemophilia A patients. Haematologica98, 1481–1486. [PMC free article] [PubMed] [Google Scholar]
- Kawano Y. & Cohen D.E. (2013) Mechanisms of hepatic triglyceride accumulation in non‐alcoholic fatty liver disease. J. Gastroenterol.48, 434–441. [PMC free article] [PubMed] [Google Scholar]
- Kiouptsi K., Grill A., Mann A.etal (2017) Mice deficient in the anti‐haemophilic coagulation factor VIII show increased von Willebrand factor plasma levels. PLoS ONE12, e0183590. [PMC free article] [PubMed] [Google Scholar]
- Kotronen A., Joutsi‐Korhonen L., Sevastianova K.etal (2011) Increased coagulation factor VIII, IX, XI and XII activities in non‐alcoholic fatty liver disease. Liver Int.31, 176–183. [PubMed] [Google Scholar]
- Kumaran V., Benten D., Follenzi A.etal (2005) Transplantation of endothelial cells corrects the phenotype in hemophilia A mice. J. Thromb. Haemost.3, 2022–2031. [PubMed] [Google Scholar]
- Majumdar S., Morris A., Gordon C.etal (2010) Alarmingly high prevalence of obesity in haemophilia in the state of Mississippi. Haemophilia16, 455–459. [PubMed] [Google Scholar]
- Miyao M., Kotani H., Ishida T.etal (2015) Pivotal role of liver sinusoidal endothelial cells in NAFLD/NASH progression. Lab. Invest.95, 1130–1144. [PubMed] [Google Scholar]
- Reddy G.K. & Enwemeka C.S. (1996) A simplified method for the analysis of hydroxyproline in biological tissues. Clin. Biochem.29, 225–229. [PubMed] [Google Scholar]
- Revel‐Vilk S., Komvilaisak P., Blanchette V.etal (2011) The changing face of hepatitis in boys with haemophilia associated with increased prevalence of obesity. Haemophilia17, 689–694. [PubMed] [Google Scholar]
- Tripodi A., Fracanzani A.L., Primignani M.etal (2014) Procoagulant imbalance in patients with non‐alcoholic fatty liver disease. J. Hepatol.61, 148–154. [PubMed] [Google Scholar]
- Verma S., Jensen D., Hart J. & Mohanty S.R. (2013) Predictive value of ALT levels for non‐alcoholic steatohepatitis (NASH) and advanced fibrosis in non‐alcoholic fatty liver disease (NAFLD). Liver Int.33, 1398–1405. [PubMed] [Google Scholar]
- Wong T.E., Majumdar S., Adams E.etal (2011) Overweight and obesity in hemophilia: a systematic review of the literature. Am. J. Prev. Med.41(6 Suppl 4), S369–S375. [PubMed] [Google Scholar]
- Xu B., Broome U., Uzunel M.etal (2003) Capillarization of hepatic sinusoid by liver endothelial cell‐reactive auto antibodies in patients with cirrhosis and chronic hepatitis. Am. J. Pathol.163, 1275–1289. [PMC free article] [PubMed] [Google Scholar]
Articles from International Journal of Experimental Pathology are provided here courtesy of Wiley
